Journal: Cell Death & Disease

Article Title: p62 mRNA suppresses NLRP1 expression in cutaneous SCC cells through miR-34a-5p

doi: 10.1038/s41419-025-07785-9

Figure Lengend Snippet: A , B HPKs from two different donors were compared with SCC12 and SCC13 cells. A mRNA levels of SQSTM1 (p62), NLRP1, or ( B ) miRNA34a-5p were determined via qPCR. ( C, D ) HPKs ( N = 2) and SCC12 cells ( N = 3) were transfected with control (ctr.) antagomir or miR-34a-5p antagomir or treated with lipofectamine only, and analyzed using qPCR. A–D Data are represented as mean ± SD of three experiments ( A , B ) where two donors in the group of HPKs ( N = 6) and two SCC cell lines (SCC12, SCC13) in the group of SCCs ( N = 6) were subjected to two-tailed unpaired t-test with Welch’s correction or ( C, D ) one-way analysis of variance with Dunnett’s multiple comparison test. (**** P < 0.001, *** P ≤ 0.001, ** P ≤ 0.01, and * P ≤ 0.05, ns = not significant). SCC squamous cell carcinoma, HPK human primary keratinocyte, lipo lipofectamine.

Article Snippet: 80% on the day of transfection with Lipofectamine 2000 (Invitrogen) (2.5 ul per well of 12 well plate) and 75 nM of antagomir (HY-RI00714A hsa-miR-34a-5p antagomir, MedChemExpress)/ control (HY-RI04602A MicroRNA Antagomir Negative Control MedChemExpress).

Techniques: Transfection, Control, Two Tailed Test, Comparison

Journal: Cell Death & Disease

Article Title: p62 mRNA suppresses NLRP1 expression in cutaneous SCC cells through miR-34a-5p

doi: 10.1038/s41419-025-07785-9

Figure Lengend Snippet: In healthy skin, keratinocytes express high levels of NLRP1 and of the tumor suppressor miR-34a, while p62 expression remains relatively low. In cutaneous squamous cell carcinoma (cSCC) tumor cells, the expression of NLRP1 and miR-34a is decreased, while p62 expression is elevated. p62 mRNA negatively regulates miR-34a, while miR-34a positively regulates NLRP1 mRNA expression. Consequently, the increased expression of p62 in SCC cells leads to the suppression of NLRP1 expression, mediated by a decrease in miR-34a. Most likely, miR-34a does directly interact neither with p62 mRNA nor with NLRP1 mRNA.

Article Snippet: 80% on the day of transfection with Lipofectamine 2000 (Invitrogen) (2.5 ul per well of 12 well plate) and 75 nM of antagomir (HY-RI00714A hsa-miR-34a-5p antagomir, MedChemExpress)/ control (HY-RI04602A MicroRNA Antagomir Negative Control MedChemExpress).

Techniques: Expressing

Journal: Nature Communications

Article Title: Hepatic Crtc2 controls whole body energy metabolism via a miR-34a-Fgf21 axis

doi: 10.1038/s41467-017-01878-6

Figure Lengend Snippet: Hepatic miR-34a is critical in reducing Sirt1-Pparα-mediated expression of Fgf21 in a Creb/Crtc2-dependent manner. a Effects of hepatic Crtc2 knockout on protein levels of Atf4, Foxo1, and Pparα in the livers of 16 h-fasted, 9-week HFD-fed mice. b Effects of hepatic Crtc2 knockout on mature microRNA expression in the livers of 16 h-fasted, 9-week HFD-fed mice (left) (Q-PCR, n = 4 mice per group). Levels of AGO2-associated miR-34a were also shown (right) (Q-PCR, n = 4 mice per group). c Effects of hepatic Crtc2 knockout on protein levels in the livers of 16 h fasted, 9-week HFD-fed mice. Quantitation of protein levels of each condition was shown at right. d , e Effects of expression of constitutively active form of Crtc2 (S171A) on hepatic genes. 8-week old C57BL/6 mice were injected with adenovirus for 5 days before being killed after 24 h fasting. Hepatic miR-34a levels ( d , left), hepatic expression of Pparα target genes ( d , right), hepatic protein levels ( e , left), and quantitation of protein levels ( e , right) from C57BL/6 mice that were infected with Ad-GFP or Ad-Crtc2 S171A adenovirus ( n = 5 mice per group). f 5′- and 3′-deletion analysis was performed to map the putative Creb/Crtc2 response element on the promoter of mouse miR-34a (top). Luciferase reporter assay was performed in 293T cells to determine the effects of Creb/Crtc2 on miR-34a promoter activity (bottom). N = 3 independent experiments in triplicate. g Location of putative CREs on the mouse miR-34a promoter (top), the effects of CRE mutations on the mouse miR-34a promoter activity (left), and the chromatin immunoprecipitation assay showing the occupancy of Creb/Crtc2 over mouse miR-34a promoter (right) were shown. N = 3 independent experiments in triplicate. Note that the HFD was initiated at 4 weeks of age and maintained throughout the experimental period ( a – c ). Data in b – g represent mean ± s.d. (* P < 0.05, ** P < 0.01, t -test)

Article Snippet: Human miR-34a promoter was excised from the pGL3-PMT-miR-34a plasmid (a gift from Judy Lieberman (Addgene plasmid #25799) , and was subcloned into the pGL4 vector to generate the human full-length miR-34a luciferase plasmid.

Techniques: Expressing, Knock-Out, Quantitation Assay, Injection, Infection, Luciferase, Reporter Assay, Activity Assay, Chromatin Immunoprecipitation

Journal: Nature Communications

Article Title: Hepatic Crtc2 controls whole body energy metabolism via a miR-34a-Fgf21 axis

doi: 10.1038/s41467-017-01878-6

Figure Lengend Snippet: Effect of miR-34a on adiposity is reversed by co-expression of Fgf21 in Crtc2 liver-specific knockout mice. a – d Effects of miR-34a and/or Fgf21 on Crtc2 LKO mice under 9-week HFD ( n = 5 mice per group). Schematics of AAV injection ( a , top) and the effect of miR-34a and Fgf21 on fat size ( a , bottom) were shown. H&E staining of the liver, scWAT, visWAT, BAT of each group of mice were shown ( b ). c Western blot analysis showing hepatic protein levels, as well as Ucp1 protein levels in scWAT and BAT of each genotype. Data represent four independent experiments ( n = 4 mice per group). Note that the HFD was initiated at 4 weeks of age and maintained throughout the experimental period. d Schematic diagram showing the effects of Creb/Crtc2-driven expression of miR-34a on hepatic fatty acid metabolism and whole-body energy homeostasis under diet-induced obesity (DIO) and insulin-resistant conditions. Depletion of Crtc2 promotes the activation of Sirt1/Pparα pathway under DIO conditions, leading to the increased hepatic fatty acid beta oxidation and the amelioration of fatty liver symptoms. In addition, enhanced hepatic Fgf21 expression is also essential in improving lipid metabolism in the peripheral tissues including the liver and adipose tissues, resulting in the increased energy expenditure and the improved insulin sensitivity

Article Snippet: Human miR-34a promoter was excised from the pGL3-PMT-miR-34a plasmid (a gift from Judy Lieberman (Addgene plasmid #25799) , and was subcloned into the pGL4 vector to generate the human full-length miR-34a luciferase plasmid.

Techniques: Expressing, Knock-Out, Injection, Staining, Western Blot, Activation Assay

Journal: Cells

Article Title: The Effect of Ursodeoxycholic Acid (UDCA) on Serum Expression of miR-34a and miR-506 in Patients with Chronic Cholestatic Liver Diseases

doi: 10.3390/cells14151137

Figure Lengend Snippet: Basal serum expression levels of miR-34a and miR-506 in patients with PBC and PSC before the introduction of UDCA treatment. miR-34a ( A ) expression was significantly elevated in PBC patients compared to age- and sex-matched healthy controls, while no significant difference was observed in PSC patients due to high intra-group variability. miR-506 ( B ) expression was markedly elevated—by several-dozen-fold—in PBC patients relative to controls. Comparisons between experimental groups were performed using the Mann–Whitney U test. Data are presented as mean ± SEM. Abbreviations: PBC, primary biliary cholangitis; PSC, primary sclerosing cholangitis; UDCA, ursodeoxycholic acid.

Article Snippet: The levels of miR-34a (478048_mir) and miR-506 (478958_mir), along with miR-16 (477860_mir), which was used as an endogenous control, were measured using TaqMan ® Advanced miRNA Assays (Applied Biosystems).

Techniques: Expressing, MANN-WHITNEY

Journal: Cells

Article Title: The Effect of Ursodeoxycholic Acid (UDCA) on Serum Expression of miR-34a and miR-506 in Patients with Chronic Cholestatic Liver Diseases

doi: 10.3390/cells14151137

Figure Lengend Snippet: The effect of UDCA treatment on the serum expression of miR-34a and miR-506. UDCA suppressed the expression of miR-34a ( A ) and miR-506 ( C ) in patients with PBC but not PSC ( B ). Each symbol represents one patient. A Student’s paired t -test was used to test statistical significance. The median duration of UDCA administration was 44 months (range: 22–56 months). PBC, primary biliary cholangitis; PSC, primary sclerosing cholangitis; UDCA naive, values before the introduction of ursodeoxycholic acid; UDCA, after treatment with UDCA.

Article Snippet: The levels of miR-34a (478048_mir) and miR-506 (478958_mir), along with miR-16 (477860_mir), which was used as an endogenous control, were measured using TaqMan ® Advanced miRNA Assays (Applied Biosystems).

Techniques: Expressing

Journal: Cells

Article Title: The Effect of Ursodeoxycholic Acid (UDCA) on Serum Expression of miR-34a and miR-506 in Patients with Chronic Cholestatic Liver Diseases

doi: 10.3390/cells14151137

Figure Lengend Snippet: Effects of UDCA on LPS-induced expression of TREM-2, miR-34a, and ADAM17 in NHC cell lines. qPCR analysis demonstrated that TREM-2 ( A ) was not induced by LPS stimulation alone; however, co-treatment with UDCA resulted in activation of this gene. The LPS-induced expression of miR-34a ( B ) and ADAM17 ( C ) mRNA was significantly suppressed by co-treatment with UDCA. Data are presented as mean ± SEM from four independent experiments. Statistical analysis was performed using two-way ANOVA followed by Fisher’s least significant difference (LSD) test. Abbreviations: ADAM17, a disintegrin and metalloprotease 17; LPS, lipopolysaccharide from Escherichia coli; NHC, normal human cholangiocytes; TREM-2, triggering receptor expressed on myeloid cells 2; UDCA, ursodeoxycholic acid.

Article Snippet: The levels of miR-34a (478048_mir) and miR-506 (478958_mir), along with miR-16 (477860_mir), which was used as an endogenous control, were measured using TaqMan ® Advanced miRNA Assays (Applied Biosystems).

Techniques: Expressing, Activation Assay

Journal: Cell Communication and Signaling : CCS

Article Title: A cancer stem cell-like phenotype is associated with miR-10b expression in aggressive squamous cell carcinomas

doi: 10.1186/s12964-020-00550-9

Figure Lengend Snippet: miR-10b is upregulated in RDEB-cSCC. a Unsupervised clustering via PCA on miRNA expression levels clearly separated RDEB-cSCC ( n = 4) and HC-cSCC ( n = 3) samples from RDEB-KC ( n = 6) and HC-KC ( n = 5). Target analysis of miR-10b, which was significantly ( p ≤ 0.05) up-regulated (≥ 2-fold) in both, b HC-cSCCs and ( c ) RDEB-cSCCs, indicated an enrichment of pathways related to aggressive tumor phenotypes like epithelial-to-mesenchymal transition (EMT) ( d ). e TaqMan qPCR ( n = 3 ind. repl., mean ± SEM, * p < 0.05, n.s. non-significant, unpaired t-test), as well as ( f ) fluorescence-based in situ hybridization (FISH) with DIG labelled miR-10b probes (green) on FFPE tissues sections of confirmed (H&E staining, top row) carcinomas also showed miR-10b dysregulation. White dashed line: tumor boundaries marked by pan-keratin staining (red). Scale bars: 100 μm (white), 500 μm (black). Sample codes ( e ) from left to right HC-KC: 1090KC, SKC013, SKC018; RDEB-KC: RDEB-55KC, RDEB-43KC, RDEB-29KC; RDEB-cSCC: RDEB-SCC1, RDEB-SCC2, RDEB-SCC62; HC-cSCC: SCC13, WT18SCC, A431

Article Snippet: TaqMan pri-miRNA assays (Thermo Fisher Scientific, 4427012, Hs03302884_pri) including the TaqMan Gene Expression Master Mix, were used.

Techniques: Expressing, Fluorescence, In Situ Hybridization, Staining

Journal: BMC Medical Genomics

Article Title: Genetic and epigenetic modifications induced by chemotherapeutic drugs: human amniotic fluid stem cells as an in-vitro model

doi: 10.1186/s12920-019-0595-3

Figure Lengend Snippet: Selected miRNAs used in the study

Article Snippet: hsa-mir-34a , 478047_mir , MI0000268 , CAAUCAGCAAGUAUACUGCCCU.

Techniques: Sequencing, Control

Journal: BMC Medical Genomics

Article Title: Genetic and epigenetic modifications induced by chemotherapeutic drugs: human amniotic fluid stem cells as an in-vitro model

doi: 10.1186/s12920-019-0595-3

Figure Lengend Snippet: Fold change in expression of miRNAs after treatments with cisplatin, etoposide and bleomycin with respect to control. In column 3, ‘↑’ represents significant (P < 0.05) increase; ‘↓’ represents significant ( P < 0.05) decrease; and ‘-’ represents non-significant (P> 0.05) change

Article Snippet: hsa-mir-34a , 478047_mir , MI0000268 , CAAUCAGCAAGUAUACUGCCCU.

Techniques: Expressing, Control

Journal: International Journal of Molecular Sciences

Article Title: Analysis of Normalizers and Neurodevelopment-Related microRNAs in the Prefrontal Cortex and in the Sperm of SHR Rats

doi: 10.3390/ijms262110589

Figure Lengend Snippet: Expression of the target and reference miRNA in the hippocampus of SHR and control rats using different candidate endogenous normalizers and their combinations. Regardless of the reference gene Let-7g ( A ), miR-34a ( B ), or miR-34a + Let-7g ( C ), no difference in miRNA expression was observed.

Article Snippet: miR-34a-5p , rno-miR-34a-5p , rno481304_mir , UGGCAGUGUCUUAGCUGGUUGU.

Techniques: Expressing, Control

Journal: Small (Weinheim an Der Bergstrasse, Germany)

Article Title: Targeted Delivery of miR‐34a via Anti‐CD47 Antibody Conjugates for Enhanced Cancer Immunotherapy in Triple Negative Breast Cancer

doi: 10.1002/smll.202504468

Figure Lengend Snippet: Strategy and mechanism of action of aCD47‐miR‐34a (Antibody‐Oligonucleotide Conjugate) for cancer immunotherapy. 1) Targeted delivery of aCD47‐C‐miR34a to CD47 overexpressed TNBC cells. 2) The aCD47‐C‐miR34 initiates binding to CD47 on tumor cell surfaces and is internalized via CD47‐mediated endocytosis. 3) In early endosomes, the linker of aCD47‐C‐miR34a is cleaved by GSH, releasing intact miR‐34a. 4) The released miR‐34a directly targets and downregulates SIRT1 and PD‐L1 mRNAs, both of which are associated with tumorigenesis. 5,6) Consequently, apoptotic cell‐induced DC activation promotes CD8⁺ T‐cell infiltration, enhancing antitumor immunity.

Article Snippet: The DBCO‐functionalized miR‐34a mimic comprising DNA (DBCO‐5′‐TGGCAGTGTCTTAGCTGGTTGT‐3′), Cy5‐labeled miR‐34a, DBCO‐miR‐34a with backbone modifications (DBCO‐5′‐ T G GC A GT G TC T TA G C T G GT T GT ‐3′), underlined identify locked nucleic acids (LNAs), and italics represent phosphorothioate (ps) linkages, and Cy5‐labeled miR‐34a with backbone modifications, were purchased from Bioneer (Republic of Korea).

Techniques: Binding Assay, Activation Assay

Journal: Small (Weinheim an Der Bergstrasse, Germany)

Article Title: Targeted Delivery of miR‐34a via Anti‐CD47 Antibody Conjugates for Enhanced Cancer Immunotherapy in Triple Negative Breast Cancer

doi: 10.1002/smll.202504468

Figure Lengend Snippet: Characterization of aCD47‐C‐miR34a (Antibody‐Oligonucleotide Conjugate) a) Schematic of the Antibody‐Oligonucleotide Conjugate designed with a covalently attached GSH‐cleavable linker (aCD47‐C‐miR34a). b) Representative 12% reducing SDS‐PAGE gel images showing the conjugation of non‐cleavable linker‐containing aCD47 with miR‐34a at different molar ratios. The results are presented for both the heavy chain (left) and the light chain (right) of aCD47. The gels were stained with Coomassie dye (upper panel) to show protein bands and imaged with fluorescence (lower panel) to detect miR‐34a. c) Representative native gel (4‐15%) images showing the conjugation of cleavable linker‐containing aCD47 with miR‐34a at various molar ratios. d) Whole protein mass analysis of aCD47, aCD47‐linker, miR‐34a, and aCD47‐C‐miR34a. The conjugation reaction between aCD47 and miR‐34a was analyzed at a 1:4 molar ratio. MW, molecular weight. e) The DoC was calculated using the relative peak intensities obtained from whole protein mass analysis. The Coomassie‐stained native gel (4–15%) analysis also verified the conjugation of miR‐34a to the aCD47‐linker. f) Representative native gel (4‐15%) images of aCD47‐C‐miR34a, visualized by Coomassie staining. g, h) Cy5 detection on the same gel, with quantitative analysis of fluorescence band intensities to evaluate the release of Cy5‐labeled miR‐34a following DTT reduction.

Article Snippet: The DBCO‐functionalized miR‐34a mimic comprising DNA (DBCO‐5′‐TGGCAGTGTCTTAGCTGGTTGT‐3′), Cy5‐labeled miR‐34a, DBCO‐miR‐34a with backbone modifications (DBCO‐5′‐ T G GC A GT G TC T TA G C T G GT T GT ‐3′), underlined identify locked nucleic acids (LNAs), and italics represent phosphorothioate (ps) linkages, and Cy5‐labeled miR‐34a with backbone modifications, were purchased from Bioneer (Republic of Korea).

Techniques: SDS Page, Conjugation Assay, Staining, Fluorescence, Molecular Weight, Labeling

Journal: Small (Weinheim an Der Bergstrasse, Germany)

Article Title: Targeted Delivery of miR‐34a via Anti‐CD47 Antibody Conjugates for Enhanced Cancer Immunotherapy in Triple Negative Breast Cancer

doi: 10.1002/smll.202504468

Figure Lengend Snippet: CD47‐mediated intracellular delivery and endosomal escape of aCD47‐miR34a in vitro. a) Flow cytometry analysis showing the cellular uptake of 25 nM Cy5‐labeled miR‐34a or aCD47‐C‐miR34a in 4T1 cells. The cells were pre‐incubated with or without 1 mg mL −1 anti‐CD47 antibodies ( n = 3). b) Representative confocal images of cellular uptake after treatment with 150 nM Cy5‐labeled miR‐34a or aCD47‐C‐miR34a in 4T1 cells. The cells were pre‐incubated with or without 1 mg mL −1 anti‐CD47 antibodies. c,d) Representative confocal images of aCD47‐miR34a endosomal escape in 4T1 cells after treatment with 150 n m aCD47‐miR34a. Colocalization of Cy5‐labeled aCD47‐miR34a (red) and early endosome (green) or lysosome (green) was observed at 1, 3, and 6 h post‐treatment. Scale bar: 50 µm. The degree of the colocalization between aCD47‐miR34a and early endosome or lysosome signals was quantified as Pearson's correlation coefficient ( r ). Fluorescence intensity per cell nucleus was calculated using ImageJ software and presented as normalized fluorescence intensity ( n = 3). Data are presented as the mean ± SD ( * p <0.05, ** p <0.01, *** p <0.001, **** p <0.0001). a, b) One‐way ANOVA with Tukey's post‐hoc test. c,d) two‐tailed unpaired Student's t‐test.

Article Snippet: The DBCO‐functionalized miR‐34a mimic comprising DNA (DBCO‐5′‐TGGCAGTGTCTTAGCTGGTTGT‐3′), Cy5‐labeled miR‐34a, DBCO‐miR‐34a with backbone modifications (DBCO‐5′‐ T G GC A GT G TC T TA G C T G GT T GT ‐3′), underlined identify locked nucleic acids (LNAs), and italics represent phosphorothioate (ps) linkages, and Cy5‐labeled miR‐34a with backbone modifications, were purchased from Bioneer (Republic of Korea).

Techniques: In Vitro, Flow Cytometry, Labeling, Incubation, Fluorescence, Software, Two Tailed Test

Journal: Small (Weinheim an Der Bergstrasse, Germany)

Article Title: Targeted Delivery of miR‐34a via Anti‐CD47 Antibody Conjugates for Enhanced Cancer Immunotherapy in Triple Negative Breast Cancer

doi: 10.1002/smll.202504468

Figure Lengend Snippet: Impact of effective endosomal escape of aCD47‐miR34a in 4T1 breast cancer cell line in vitro. a,b) Representative confocal images of aCD47‐miR34a tracking the endosomal escape in 4T1 cells after treatment with 150 n m aCD47‐miR34a. Colocalization of Cy5‐labeled aCD47‐miR34a (red) and calcein (green) was observed at 1, 3, and 6 h post‐treatment. Scale bar: 25 µm. c) The degree of colocalization between aCD47‐miR34 and calcein signals was compared at various time points, quantified by Pearson's correlation coefficient ( r ). Fluorescence intensity per cell nucleus was calculated using ImageJ software and presented as normalized fluorescence intensity ( n = 6). d) Relative miR‐34a expression levels in 4T1 cells measured by RT‐qPCR. All samples were normalized to U6 expression ( n = 3). e, f) qRT‐PCR analysis of relative PD‐L1 and SIRT1 mRNA expression in 4T1 cells following treatmnt. All samples were normalized to 18s RNA expression ( n = 3). g) Western blot analysis of SIRT1 and PD‐L1 abundance in 4T1 cells after treatment with 130 n m aCD47‐C‐miR34a for 24 h, and h) quantification of protein expression levels normalized to GAPDH expression ( n = 3). i) Flow cytometry analysis showing the Annexin V/PI staining in 4T1 cell after treatment with PBS, 130 nM miR‐34a, or 130 nM aCD47‐C‐miR34a for 48 h ( n = 3). Data are presented as the mean ± SD ( * p <0.05, *** p <0.001, **** p <0.0001). c,e,f,i) Two‐way with Sidak's multiple comparison test. d, h) One‐way ANOVA with Tukey's post‐hoc test.

Article Snippet: The DBCO‐functionalized miR‐34a mimic comprising DNA (DBCO‐5′‐TGGCAGTGTCTTAGCTGGTTGT‐3′), Cy5‐labeled miR‐34a, DBCO‐miR‐34a with backbone modifications (DBCO‐5′‐ T G GC A GT G TC T TA G C T G GT T GT ‐3′), underlined identify locked nucleic acids (LNAs), and italics represent phosphorothioate (ps) linkages, and Cy5‐labeled miR‐34a with backbone modifications, were purchased from Bioneer (Republic of Korea).

Techniques: In Vitro, Labeling, Fluorescence, Software, Expressing, Quantitative RT-PCR, RNA Expression, Western Blot, Flow Cytometry, Staining, Comparison

Journal: Small (Weinheim an Der Bergstrasse, Germany)

Article Title: Targeted Delivery of miR‐34a via Anti‐CD47 Antibody Conjugates for Enhanced Cancer Immunotherapy in Triple Negative Breast Cancer

doi: 10.1002/smll.202504468

Figure Lengend Snippet: Tumor‐targeting ability and therapeutic efficacy of aCD47‐C‐miR34a in an orthotopic 4T1 TNBC model. a) In vivo fluorescence images of orthotopic 4T1 tumor‐bearing TNBC BALB/c nude mouse models following systemic administration of IgG‐C‐miR34a, miR‐34a, or aCD47‐C‐miR34a ( n = 3). b) Quantitative fluorescence intensities of IgG‐C‐miR34a, miR‐34a, or aCD47‐C‐miR34a in the tumor tissues at 0, 1, 3, and 6 h. c) Ex vivo fluorescence images of excised six major organs including the liver (Li), lung (Lu), spleen (Sp), kidney (Ki), heart (He), and tumor (Tu) harvested at 6 h after systemic administration of IgG‐C‐mR34a, miR‐34a, or aCD47‐C‐miR34a ( n = 3). d) Quantification of organ distribution of IgG‐C‐miR34a, miR‐34a, or aCD47‐C‐miR34a ( n = 3). e–g) Ex vivo fluorescence images and quantification of average radiant efficiency in 4T1 tumors harvested at 6 h after systemic administration of IgG‐C‐miR34a, miR‐34a, or aCD47‐miR34a ( n = 3). h,i) Quantification of tumor Cy5 radiant efficiency with normalized to that of liver or kidney ( n = 3). j) Schematic of the experimental design for the aCD47‐C‐miR34a administration in 4T1‐Luc tumor‐bearing TNBC mouse models. k) Bioluminescence imaging and l) total bioluminescence flux measured via IVIS Lumina, in orthotopic 4T1‐Luc tumor‐bearing mice on days 6, 9, 12, and 15 ( n = 6). m) Average tumor growth curves in orthotopic 4T1‐Luc tumor‐bearing mice treated with PBS, aCD47, or aCD47‐C‐miR34a ( n = 6). n) Image of excised orthotopic 4T1‐Luc tumors along with individual tumor growth curves for each group. o) Tumor weight on day 17 after tumor inoculation. Data are presented as the mean ± SD ( * p <0.05, ** p <0.01, *** p <0.001, **** p <0.0001). Statistical significance was calculated by b, d, l, m) two‐way ANOVA with Sidak's multiple comparison test and g, h, i, o) one‐way ANOVA followed by Tukey's multiple comparisons tests.

Article Snippet: The DBCO‐functionalized miR‐34a mimic comprising DNA (DBCO‐5′‐TGGCAGTGTCTTAGCTGGTTGT‐3′), Cy5‐labeled miR‐34a, DBCO‐miR‐34a with backbone modifications (DBCO‐5′‐ T G GC A GT G TC T TA G C T G GT T GT ‐3′), underlined identify locked nucleic acids (LNAs), and italics represent phosphorothioate (ps) linkages, and Cy5‐labeled miR‐34a with backbone modifications, were purchased from Bioneer (Republic of Korea).

Techniques: Drug discovery, In Vivo, Fluorescence, Ex Vivo, Imaging, Comparison

Journal: Small (Weinheim an Der Bergstrasse, Germany)

Article Title: Targeted Delivery of miR‐34a via Anti‐CD47 Antibody Conjugates for Enhanced Cancer Immunotherapy in Triple Negative Breast Cancer

doi: 10.1002/smll.202504468

Figure Lengend Snippet: In vivo antitumor immune response of aCD47‐C‐miR34a in an orthotopic 4T1 TNBC model. a) Relative miR‐34a expression levels in tumor tissues measured by RT‐qPCR. All samples were normalized to U6 expression ( n = 3). b,c) Representative immunofluorescence images and quantification of relative fluorescence intensities in tumor tissues stained with APC‐conjugated PD‐L1 antibody or TUNEL staining ( n = 3). Scale bar: 200 µm. d–f) The percentage of mature DCs (CD11c + CD40 + , CD86 + , or CD80 + ) in TDLN ( n = 3). g) The percentage of total T‐cells (CD45.2⁺CD3⁺CD8⁺) and h–j) activated CD8 + T‐cells (CD45.2 + CD3 + CD8 + Granzyme B + , CD44 + , or Ki67 + ) in tumor tissues ( n = 3). k) Representative immunofluorescence images of whole tumor sections to visualize the distribution and activation status of CD8⁺ T‐cells, stained with APC‐conjugated CD8 antibody and FITC‐conjugated Granzyme B antibody. Scale bar, 1 mm. Data are presented as the mean ± SD ( * p <0.05, ** p <0.01, *** p <0.001, **** p <0.0001). Statistical significance was calculated by a,d,e,f,g–j) one‐way ANOVA followed by Tukey's multiple comparisons test.

Article Snippet: The DBCO‐functionalized miR‐34a mimic comprising DNA (DBCO‐5′‐TGGCAGTGTCTTAGCTGGTTGT‐3′), Cy5‐labeled miR‐34a, DBCO‐miR‐34a with backbone modifications (DBCO‐5′‐ T G GC A GT G TC T TA G C T G GT T GT ‐3′), underlined identify locked nucleic acids (LNAs), and italics represent phosphorothioate (ps) linkages, and Cy5‐labeled miR‐34a with backbone modifications, were purchased from Bioneer (Republic of Korea).

Techniques: In Vivo, Expressing, Quantitative RT-PCR, Immunofluorescence, Fluorescence, Staining, TUNEL Assay, Activation Assay

Journal: Small (Weinheim an Der Bergstrasse, Germany)

Article Title: Targeted Delivery of miR‐34a via Anti‐CD47 Antibody Conjugates for Enhanced Cancer Immunotherapy in Triple Negative Breast Cancer

doi: 10.1002/smll.202504468

Figure Lengend Snippet: H&E‐stained images from a tumor growth inhibition study showing sections of extracted visceral organs from an orthotopic 4T1 TNBC model. a) Average body weight curves in orthotopic 4T1‐Luc tumor‐bearing mice treated with PBS, aCD47, or aCD47‐C‐miR34a ( n = 6). b) Total WBC and percentages of different blood cell types were analyzed after mice sacrifice. Normal range c) H&E‐stained images from a tumor growth inhibition study showing sections of the five major visceral organs extracted from the 4T1 orthotopic TNBC model. Scale bar: 200 µm. Data are presented as the mean ± SD ( * p <0.05, ** p <0.01, *** p <0.001, **** p <0.0001). a) One‐way ANOVA followed by Tukey's multiple comparisons test.

Article Snippet: The DBCO‐functionalized miR‐34a mimic comprising DNA (DBCO‐5′‐TGGCAGTGTCTTAGCTGGTTGT‐3′), Cy5‐labeled miR‐34a, DBCO‐miR‐34a with backbone modifications (DBCO‐5′‐ T G GC A GT G TC T TA G C T G GT T GT ‐3′), underlined identify locked nucleic acids (LNAs), and italics represent phosphorothioate (ps) linkages, and Cy5‐labeled miR‐34a with backbone modifications, were purchased from Bioneer (Republic of Korea).

Techniques: Staining, Inhibition